Research Article

Role of interleukin-4 genetic polymorphisms and environmental factors in the risk of asthma in children

Published: November 03, 2016
Genet. Mol. Res. 15(4): gmr15048873 DOI: 10.4238/gmr15048873

Abstract

Asthma is an allergic disease characterized by hyperresponsiveness and chronic inflammation of the airway. The interleukin-4 (IL-4) gene and its single nucleotide polymorphisms are associated with asthma susceptibility in children. A case-control study was performed to evaluate the relationship between asthma risk and the IL-4 rs2243250 (589 C/T) and rs2070874 (107 T/C), and IL-4 receptor (IL-4R) rs1801275 (576 Q/R) polymorphisms in 317 childhood asthma patients and 351 healthy children as controls. Polymerase chain reaction amplification and sequencing was performed. The effects of interactions between the genes of interest and environmental factors were also analyzed. IL-4 rs2243250 and rs2070874 allele and genotype frequencies did not significantly differ between the asthma and control groups (P > 0.05), but those of IL-4R rs1801275 did (P < 0.05). The RR genotype and R allele of this IL-4R variant were significantly associated with asthma risk, with odds ratios (ORs; and 95% confidence intervals) of 2.97 (2.08-4.25) and 2.99 (2.32-3.85), respectively. Logistic regression analysis showed that the IL-4R 576 Q/R RR genotype demonstrated a positive interaction with environments associated with smoking or pets in its effect on asthma risk, with ORs of 2.18 (P = 0.02) and 2.29 (P = 0.01), respectively. Our results suggest that the IL-4R rs1801275 polymorphism is associated with childhood asthma, and the RR genotype confers a high risk of developing this condition. This variant exhibited positive interactions with environments in which smoking or pets were present in increasing the risk of childhood asthma.

 

INTRODUCTION

Asthma is a chronic allergic inflammatory disease of the airway. It is estimated that there are currently 300 million asthma patients worldwide, and the associated morbidity and mortality rates have been steadily increasing (Masoli et al., 2004). The global economic burden of asthma exceeds that of tuberculosis, human immunodeficiency virus infection, and acquired immune deficiency syndrome combined (Wills-Karp et al., 1998), and this disease has become a major public health problem globally (Jaakkola and Jaakkola, 2012).

As a complex disease, the pathogenesis of asthma remains unclear (Cook and Saglani, 2016). However, several studies have shown that it involves inflammatory immune cells (Cook and Saglani, 2016), the secretion of inflammatory mediators, and cytokine interactions (Osei-Kumah et al., 2006), leading to immunoglobulin (Ig) E-mediated hypersensitivity and eosinophil infiltration of the airway, causing chronic inflammation (Wongratanacheewin, 2014). Several complex and diverse risk factors contribute to the development of asthma, involving environment, immunity, lifestyle, and psychology (Hovland et al., 2015; Toskala and Kennedy, 2015; Demirdag and Ramadan, 2016). Many studies concerning this condition have been carried out, mainly focusing on epidemiological and genetic risk factors. It is widely believed that the occurrence of asthma is determined by the compounded effects of numerous genes and environmental aspects, including gene-gene and gene-environment interactions (Gonzalez-Garcia et al., 2015). In recent decades, single nucleotide polymorphisms have become one of the most commonly studied types of sequence variation in investigations of the relationship between genetics and disease susceptibility (Sengler et al., 2002; Tulah et al., 2013).

Interleukin-4 (IL-4) is primarily produced by Th2 cells (Smallwood et al., 2016). The biological function of IL-4 principally comprises increasing B cell major histocompatibility complex class II molecule expression, promoting resting B cell FcεR expression, elevating secretion of IgE and IgG1 in the activation of B cells, and stimulating IgG to IgE class switching in an autocrine manner to facilitate the differentiation of Th2 cells, while inhibiting Th1 cell proliferation and the Th1 response (Antczak et al., 2016; Pattnaik et al., 2016).

To date, many investigations have tested the association between IL-4 polymorphisms and asthma risk, but their results have not been consistent (Micheal et al., 2013; Tang et al., 2014; Huang et al., 2015; Bal et al., 2016). Therefore, we performed a case-control study to analyze the relationship between three IL-4-related loci [rs2243250 (589 C/T) and rs2070874 (107 T/C) in IL-4, and rs1801275 (576 Q/R) in the IL-4 receptor α-chain gene (IL-4R)] and risk of childhood asthma. Moreover, the effects of interactions between environmental factors and genotypes on risk were also assessed.

MATERIAL AND METHODS

Subjects

From March 2012 to March 2016, we continuously recruited 317 patients with asthma at the Weinan Central Hospital Department of Pediatrics. Asthma was diagnosed according to the Global Initiative for Asthma guidelines (Borish, 2010). Cases were graded by severity according to clinical features into intermittent, mild sustained, moderate continued, and severe sustained categories. Patients with other respiratory diseases, such as recent upper or lower respiratory tract infections, were excluded from our study. A standard questionnaire was filled out by patients or their parents, and pulmonary function, chest X-ray, and other necessary examinations were performed. Diagnosis of atopic disease was based on the skin prick test (SPT).

During the same period, a total of 351 healthy children were selected as a control group. This group comprised individuals having visited our hospital for the treatment of diseases other than asthma or atopic asthma. All subjects were unrelated Han Chinese individuals residing in the vicinity of the hospital, and their parents’ consent and cooperation were obtained. This study was approved by the Ethics Committee of our hospital.

Blood samples and DNA extraction

Between 7:00 and 9:00 a.m., 5-mL blood samples were collected in sterile vacuum tubes containing ethylenediaminetetraacetic acid. Each blood sample was centrifuged at 1300 rpm for 10 min at 4°C, and the upper plasma layer was stored at -70°C, while the buffy coat was preserved at -20°C before extraction of genomic DNA using a QIAamp DNA Blood Mini kit (QIAGEN, Hilden, Germany) following the manufacturer protocol.

Genotyping

Polymerase chain reaction (PCR) amplification and DNA sequencing were used. Primers were designed with Autoprimer (http://www.autoprimer.com) and synthesized by Shanghai SangGong (Shanghai, China). Primer sequences are shown in Table 1. PCRs consisted of 50-µL mixtures containing 75 µM deoxynucleotides, 20 ng genomic DNA, 50 nM primers, 3.5 mM MgCl2, and 0.5 U HotStarTaq polymerase. Using 96-well plates, PCRs were carried out as follows: 95°C for 15 min, then 40 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 60 s, before a final step at 72°C for 7 min. PCR products were stored at 4°C and subsequently sequenced.

Polymerase chain reaction primers used in this study.

SNP Primer Sequence (5'-3')
rs2243250 Forward AAACTAGGCCTCACCTGATACG
(C/T) Reverse TGCATAGAGGCAGAATAACAGG
rs2070874 Forward GAGGTGAGACCCATTAATAG
(T/C) Reverse ACGTTGGATGTGCATCGTTAGCTTCTCCTG
rs1801275 Forward GAGGAAGTAGAACCCGAGATGC
(Q/R) Reverse GCAGCCAGGAATGAGGTCTT

SNP = single nucleotide polymorphism.

Statistical analysis

SPSS 17.0 (SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Demographic and clinical variables of the patients and controls were compared by the t-test or chi-square test. Hardy-Weinberg equilibrium (HWE) of genotype frequencies in the control group was assessed by the goodness-of-fit chi-square test. Differences in genotype, allele, and haplotype frequencies between the patient and control groups were analyzed by chi-square tests, and multiple logistic regression was used to calculate odds ratios (ORs) and 95% confidence intervals (CIs). We also tested interactions between genotypes and environmental influences, such as smoking, pets, humidity, respiratory infection, and other factors. P < 0.05 was considered statistically significant.

RESULTS

The general characteristics of the patients and control subjects are shown in Table 2. No statistically significant differences in average age or sex were observed between the two groups. Of the 317 asthma patients, 237 (75.00%) had positive SPT results. Concerning disease severity, 70 patients (22.01%) presented with intermittent, 50 (15.72%) with mild sustained, 87 (27.36%) with moderate continued, and 110 (34.91%) with severe sustained asthma.

Comparison of the general characteristics of each study group.

N Average age (years) Gender (%) SPT-positive (%) Asthma classification (%)
Male Female Intermittent Mild sustained Moderate continued Severe sustained
Patients 317 5.80 ± 4.24 134 (42.45) 183 (57.55) 237 (75.00) 70 (22.01) 50 (15.72) 87 (27.36) 110 (34.91)
Controls 351 6.26 ± 3.31 151 (43.18) 200 (56.82) 0 - - - -
P value >0.05 >0.05

SPT = skin prick test.

IL-4 rs2243250 and rs2070874 and IL-4R rs1801275 allele frequencies were consistent with HWE (P > 0.05). Comparing the asthma and healthy control groups, no differences in the distribution of IL-4 rs2243250 or rs2070874 alleles were evident. However, IL-4R rs1801275 allele frequencies did significantly differ between these groups (P < 0.05). The IL-4R 576 Q/R RR genotype and R allele were significantly more common among asthma patients, with ORs (and 95%CIs) of 2.97 (2.08-4.25) and 2.99 (2.32-3.85), respectively, as shown in Table 3.

Allele and genotype frequencies of the three loci considered in this study.

Locus Allele or genotype Patients [N (%)] Controls [N (%)] Chi-square P HWE OR (95%CI)
rs2243250 T 452 (71.29) 518 (73.79) 0.819 1
C 182 (28.71) 184 (26.21) 1.04 0.31 0.88 (0.69-1.12)
TT 205 (64.67) 213 (60.68) 1
CC 112 (35.33) 138 (39.32) 1.13 0.29 1.19 (0.87-1.62)
rs2070874 C 358 (56.47) 416 (59.26) 0.12 1
T 276 (43.53) 286 (40.74) 1.07 0.30 0.89 (0.72-1.11)
CC 147 (46.37) 170 (48.43) 1
TT 170 (53.63) 181 (51.57) 0.28 0.59 0.92 (0.68-1.25)
rs1801275 Q 386 (71.90) 578 (85.00) 0.302 1
R 248 (28.10) 124 (15.00) 119.39 <0.05 2.99 (2.32-3.85)
QQ 195 (61.50) 290 (82.62) 1
RR 122 (38.50) 61 (17.38) 37.31 <0.05 2.97 (2.08-4.25)

HWE = Hardy-Weinberg equilibrium, OR = odds ratio, CI = confidence interval.

The IL-4R 576 Q/R polymorphism demonstrated a positive interaction with environments affected by smoking (principally those involving family members smoking; OR = 2.18, 95%CI = 1.15-4.13), pets (OR = 2.29, 95%CI = 1.22-4.28), and damp (OR = 3.54, 95%CI = 1.99-6.28), as displayed in Table 4.

Interactions between the IL-4R576 Q/R polymorphism and environmental factors.

Factor Genotype B SE Wald P OR 95%CI
Smoking related-environment QQ 0.29 0.29 1.01 0.32 1.34 0.76-2.38
RR 0.78 0.33 5.67 0.02 2.18 1.15-4.13
Pets QQ 0.11 0.28 0.15 0.7 1.12 0.65-1.93
RR 0.83 0.32 6.69 0.01 2.29 1.22-4.28
Humidity Damp QQ 0.55 0.28 3.93 0.08 1.73 1.01-2.98
RR 1.26 0.29 8.67 0.04 3.54 1.99-6.28
Dry QQ 0.13 0.22 1.15 0.42 1.02 0.67-1.83
RR 0.27 0.23 1.09 0.35 1.14 0.78-2.08
Respiratory infections QQ 0.33 0.23 1.17 0.22 1.52 0.77-1.86
RR 0.17 0.29 1.39 0.55 1.64 0.88-2.02

SE = standard error, OR = odds ratio, CI = confidence interval.

DISCUSSION

Bronchial asthma is one of the most common chronic diseases, particularly among children. Approximately 30-50% of childhood asthma cases persist into adulthood, and an estimated 4.4 million children in the USA suffer from this condition (Eaton et al., 2008; Boulet et al., 2012), with 10.9% of high school students being affected (Akinbami and Schoendorf, 2002). Asthma may gradually evolve into chronic obstructive pulmonary disease or pulmonary heart disease.

A series of polymorphisms associated with a variety of asthma phenotypes have been identified in the IL-4 gene. For instance, it has been suggested previously that the 589 C/T variant in the IL-4 promoter region is connected to decreased FEV1 (Lee et al., 2004). Such relationships have been confirmed in populations in Japan and the USA (Nambu and Holgate, 2009; Zahran and Bailey, 2013), but not China and Arabia (Al-Mazam and Mohamed, 2001; Chen et al., 2013). The IL-4 and IL-13 genes are located on chromosome 5q31, a site potentially linked to atopic asthma. Other studies have reported that IL-4R plays an important role in the occurrence of asthma (Cui et al., 2003). The protein encoded by this gene is a key functional component of Th2 cells. IL-4R-deficient mice are unable to produce IgE and exhibit a defective Th2 response, implying that IL-4R is important in IgE regulation, and that corresponding sequence variations can affect signal transduction and increase asthma risk (Barner et al., 1998). IL-4R has been considered as an important candidate gene in atopic asthma susceptibility (Barner et al., 1998). It has been reported that three IL-4R alleles, Ile50, Pro478, and Arg551, are related to susceptibility to asthma. Andrews et al. (2001) analyzed the association between asthma risk and IL-4R 576 Q/R genotypes, alleles, and haplotypes, finding that these variants are in linkage disequilibrium and are associated with development of atopic asthma. Other studies have also identified Gln576Arg as a risk factor for this condition. For instance, Rosa-Rosa et al. (1999) examined 149 asthma patients and 57 healthy controls, and established a strong association between the IL-4R 576Arg allele and asthma severity, suggesting that IL-4R is implicated in allergic asthma and may be used as a marker to classify the clinical severity of this disease. In our study, the IL-4 589 C/T and 107 T/C polymorphisms demonstrated no relationship with asthma susceptibility, whereas IL-4R 576 Q/R did.

However, some previous findings are inconsistent with the results of the present study and those of the above studies. For example, Mak et al. (2007) performed an investigation of 292 asthma patients and 292 healthy controls in Hong Kong, concluding that the IL-4 589 C/T and IL-4R Gln576Arg variants do not significantly correlate with asthma risk in this population. Hosseini-Farahabadi et al. (2007) studied 30 asthma patients and 50 normal controls from an Iranian population, and demonstrated an association between IL-4 589 C/T and asthma. Kamali-Sarvestani et al. (2007) also confirmed this polymorphism to be associated with this disease in a southern Iranian population. In addition, Li et al. (2008) performed a meta-analysis showing that this sequence variation plays an important role in asthma pathogenesis, although the authors suggested that further work is needed to confirm the mechanism responsible.

In conclusion, we suggest that the RR genotype of the IL-4R 576 Q/R variant may increase risk of asthma, and in exerting this effect, demonstrates a significant interaction with environments associated with smoking and pets. Further studies with large sample sizes are greatly needed to confirm the relationship between IL-4 genetic polymorphisms and asthma pathogenesis.

About the Authors