Research Article

Development of coding single nucleotide polymorphic markers in the pearl oyster Pinctada fucata based on next-generation sequencing and high-resolution melting analysis

Published: November 03, 2016
Genet. Mol. Res. 15(4): gmr15049054 DOI: 10.4238/gmr15049054

Abstract

The pearl oyster Pinctada fucata is an important commercial marine shellfish that is cultured for producing saltwater pearls. In this study, 468 single nucleotide polymorphisms (SNPs) were screened from P. fucata transcriptome data, and 119 polymorphic SNPs were successfully isolated by a two-step small-amplicon high-resolution melting assay. Of these, 88 were annotated with BLAST in the Nr database and 90 were in the open reading frame, including 16 non-synonymous SNPs and 74 synonymous SNPs; 12 SNPs were in the 3'-untranslated region (UTR) and 1 was in the 5'-UTR. Twenty-five SNPs were randomly chosen to test the genetic diversity of 40 wild individuals from Liusha Bay, China. All of the loci had two alleles. The observed and expected heterozygosities ranged from 0.0417 to 0.6042 and from 0.2945 to 0.5053, respectively. Minor allele frequencies ranged from 0.1771 to 0.5000, and the polymorphism information content ranged from 0.2516 to 0.3750. These novel SNP markers can contribute to P. fucata genetics and breeding studies.

INTRODUCTION

The pearl oyster, Pinctada fucata, is an important commercial marine shellfish that is cultured for producing saltwater pearls in China, Japan, and Australia (Yu and Chu, 2006). It is also an important animal model for investigating biomineralization (i.e., scientific, medical, and commercial applications) and evolutionary biology (Jones et al., 2013). Pearl quality has recently decreased in both China and Japan. One possible reason is that the growth performance of P. fucata is hampered by inbreeding during aquaculture (Wada and Komaru, 1996; Qiu et al., 2014).

Genetic markers are powerful genetics study tools, particularly for genetic mapping and trait improvement (Huang et al., 2014a). Because of their abundance, value, and efficiency, single nucleotide polymorphisms (SNPs) have become the most powerful marker system for genetic research (Gomez-Uchida et al., 2014). Compared to non-coding genomic markers, SNPs developed from functional genes may be responsible for traits of commercial interest in this species, such as growth, reproduction, and resistance (Gao et al., 2013; Klinbunga et al., 2015; Ranjan et al., 2015). Transcriptome sequencing with next-generation sequencing technologies could provide extensive resources for large-scale gene-associated SNP mining (Grabherr et al., 2011). High-resolution melting (HRM) has proven to be a simple, low-cost, and highly sensitive technique to detect SNPs, and to profile genetic variation within polymerase chain reaction (PCR) amplicons (Cui et al., 2013).

In this study, the genetic diversity and structure of a wild population of P. fucata from South China were examined. A total of 119 polymorphic SNPs from the transcriptome sequence were successfully isolated by HRM analysis, which can contribute to P. fucata genetics and breeding studies.

MATERIAL AND METHODS

DNA extraction

Forty-eight wild adult individuals of P. fucata (shell length, 3-4 cm) were obtained from Liusha Bay, Zhanjiang, Guangdong province, China (109°49'E, 20°26'N). Each adductor muscle was cut and stored in 95% ethanol. Genomic DNA was extracted using a Marine Animals DNA Kit (Tiangen, China) according to the manufacturer specifications. DNA integrity and purity were determined by agarose gel (1%) electrophoresis and spectrophotometry (NanoDrop 2000; Thermo Fisher Scientific, USA).

Primer design

A total of 468 putative SNPs with no other predicted SNPs in the 30-bp neighboring regions were randomly chosen from P. fucata transcriptome data (Yu DH and Fan SG, unpublished data). The primers were designed by Primer Premier 5.0 (Premier Biosoft International, USA). Amplicon lengths ranged from 40 to 100 bp, primer lengths from 20 to 30 bp, the GC content was 40-60%, and the melting temperatures were 50°-60°C. The sequence and amplicon size of primers were shown in Table 1. Two unblocked double-stranded oligonucleotides were used as high- and low-temperature internal controls to calibrate the temperature variation between reactions (Table 2) (Seipp et al., 2007). All of the primers were synthesized and purified by Sangon Biotech (Shanghai, China).

Summary of 119 single nucleotide polymorphism (SNP) markers in Pinctada fucata.

Locus ID Primer sequence (5'–3') Amplicon size (bp) SNP type and location Gene annotation Amino acid change
PF_SNP1 TAGTCGCTAACACTGCCCATTAA 59 A/T 2121 Universal stress protein A-like protein (Crassostrea gigas) TT: act→aca
ACTGGATGTAGAGGATTGGGAAC
PF_SNP2 CTGAGGTATGAGAATGGAAGGGAC 81 C/T 404 Splicing factor, arginine/serine-rich 4 (Crassostrea gigas) DD: gac→gat
TGGTGCTCTGCGTGGGTT
PF_SNP4 AGATAGTCCAATCAGGTGTTCAG 86 T/A 1860 Exocyst complex component 1 (Crassostrea gigas) 3'-UTR
CAAAACTTTCTACAAGCAGGTC
PF_SNP5 TTTGTCCATTTGTTCAGCTG 80 A/T 2251 Retinal rod rhodopsin-sensitive cGMP 3',5'-cyclic phosphodiesterase subunit delta-like (Crassostrea gigas) II: ata→att
CTCGTGTTCCCAAGAAGATAC
PF_SNP6 ACCTTGTGAACAGGCGATGC 78 A/G 597 Transcription factor HES-1 (Crassostrea gigas) SS: tca→tcg
GGTCGCAAGTAGTCCGCAAAT
PF_SNP9 GGACCAAATTCCTCTTGTTCTT 47 C/G 556 Death-associated protein 1 (Crassostrea gigas) TT: acc→acg
GAACCTGCTCCAGCTCAAAC
PF_SNP13 CCACTGCCTCTTTCATTACATCT 89 C/T 1404 Nucleolar protein 56 (Nasonia vitripennis) AA: gct→gcc
ACAGCAGGTAGAAGACAGATTGA
PF_SNP14 TCATCGGTGCTGCCTCA 85 G/A 718 Nucleoprotein TPR (Crassostrea gigas) GG: ggg→gga
ACAACCCTCCCAGTCATTCC
PF_SNP18 GAGGATTTGGCATCAGACTATTCA 70 C/A 1669 Patched domain-containing protein 3 (Crassostrea gigas) QP: cag→ccg
CGTTCCTTCCCTTTGTTCTTC
PF_SNP26 GGTGAAGAGGGCTGTATTTGG 55 C/A 1089 Repressor of RNA polymerase III transcription MAF1 homolog isoform X1 (Crassostrea gigas) SS: tcc→tca
CCAGTTTGCGATTGTAGAAGAAG
PF_SNP31 ATGGACATGAGACTTGCGATCT 60 T/C 122 Putative signal peptidase complex subunit SPC25 (Crassostrea ariakensis) AA: gcc→gct
CAATAAGGCAAACAGTGAGAACC
PF_SNP33 TCGTTGTTGGAGTTTGAAGG 72 A/T 1448 GPI mannosyltransferase 1 (Crassostrea gigas) II: ataatt
GATCAGGCAAAACATAATGGA
PF_SNP34 GTTGATACTGATGAGTCGTTTG 70 A/T 729 Unknown Unknown
CACTGCCCCTATCTTACCTAT
PF_SNP38 TGTGGAAGGAGGGTAGATGT 91 T/A 304 Unknown Unknown
CTTGTATCTTCAAAACTGTGCTC
PF_SNP39 ATGGGAAGATAAACAGCAGGTA 91 T/C 1562 Hypothetical protein CGI_10011359 (Crassostrea gigas) AA: gcc-gct
CCTATTTGGTATCTCATCCTCATT
PF_SNP45 TTCGTACGTCAAGGTTCCCG 94 C/T 773 Succinate-CoA ligase GDP-forming alpha subunit (Oncorhynchus mykiss) II: atc-att
GCCTGGAGAATGTAAGATTGGTAT
PF_SNP50 CGCTTTTCTGTGCGAGTTG 100 A/G 6516 Uncharacterized protein LOC105335671 (Crassostrea gigas) VI: gtt-att
GGGATCGGAATCCTTGTTAA
PF_SNP52 CATTCTAGCTCATTCTTGATCCCC 67 G/A 1348 Wiskott-Aldrich syndrome protein family member 3 (Crassostrea gigas) VV: gtg-gta
GGATAGTAGAGCCGATCAACGTAAG
PF_SNP53 ATTGGGAAACATATCACTGGG 68 T/C 903 28S ribosomal protein S35, mitochondrial-like isoform X1 (Aplysia californica) SS: tcc-tct
CATCTGCTGTATAATGGAGACTACA
PF_SNP54 GCGGCGTTTTAATCATCTC 100 G/T 877 Fatty acid-binding protein (Procambarus clarkii) 3'-UTR
GGCATCGATCATTACCTTTCA
PF_SNP55 CCAGTCTTTGTCTGCTTTATTAA 73 C/T 621 Hypothetical protein CGI_10014470 (Crassostrea gigas) II: atc-att
ACATCCATCTCACATCCAACA
PF_SNP57 TTCACGTAATCGACCATACAAGC 69 G/A 275 Cytochrome c oxidase assembly factor 4 homolog, mitochondrial-like (Strongylocentrotus purpuratus) TA: act-gct
CCACGGAGACTGGAGAAAATG
PF_SNP58 CTTTGGATGTCATTTCCTCTGG 64 G/A 1550 Protein arginine N-methyltransferase 1 (Crassostrea gigas) EE: gag-gaa
GCAGATGCTCCACCTAAGGA
PF_SNP60 TTCCCGCATGGGTCACA 56 C/T 857 Double-stranded RNA-binding protein Staufen-like protein 2 (Crassostrea gigas) HH: cat-cac
GAAACAAGAACAGGATCTGGCTA
PF_SNP61 GCCAGAGGTTTAGAGCAAGG 82 G/C 686 Structural maintenance of chromosomes protein 5-like (Crassostrea gigas) LL: ctg-ctc
CTTGTTCTAAGCGGGCATT
PF_SNP62 GAAATCAAGGGAAACGAAGAG 58 G/T 1602 Leucine-rich repeat and fibronectin type III domain-containing protein 1-like protein (Crassostrea gigas) KN: aag-aat
CGGCTGCTTGAATAATAACG
PF_SNP64 CCGTGTGCAATAATTTCTCCTCT 55 G/A 2544 Cell division cycle 5-like protein (Crassostrea gigas) RR: cgg-cga
GGTATTAAGAAAACAGAATGGAGCC
PF_SNP66 ATATGACTACGAGATTCTCAGCAAG 74 T/A 982 N-alpha-acetyltransferase 40-like isoform X2 (Crassostrea gigas) PP: cct-cca
ATTCTCCAGCGGGTTTAGG
PF_SNP67 GGAGGAAACAAATGGAGGA 61 A/G 716 RNA polymerase-associated protein RTF1-like protein (Crassostrea gigas) KK: aaa-aag
ACCAAGTCTGTAAGTGCTGAGA
PF_SNP68 TGTCAGTACTAGCTCCCCTCAT 82 T/C 1466 Sister chromatid cohesion protein PDS5 homolog B-like (Meleagris gallopavo) SS: tct-tcc
TCTCGGGGTCGTCCAAC
PF_SNP69 CGTGATGTTTGTGGATTTGG 54 A/T 2069 Sister chromatid cohesion protein PDS5 homolog B-like (Meleagris gallopavo) LL: cta-ctt
GCTGTCTGTGATATTGCCCTAG
PF_SNP70 CTCGTATCATAACCATTGACGT 80 T/C 2984 Cullin-3-B (Crassostrea gigas) AA: gca-gcg
AGCAGCTCTGAACAACAACTTT
PF_SNP71 ACAGCTTGACAGCGCCTCT 72 G/T 232 28S ribosomal protein S5, mitochondrial (Crassostrea gigas) QK: cag-aag
CAAAACAAAACGAAAAGTTCCTAT
PF_SNP73 CAGGCAGGAGAATGTGAGA 100 T/C 376 Unknown Unknown
TGCTACACTGAAGGCTTTATGA
PF_SNP75 CCATCCATAGCCCTGCGTTTT 89 C/A 1800 Tumor necrosis factor receptor-associated factor 6 (Pinctada martensii) GG: ggc-gga
TCCCCTTGCGGCATCCAC
PF_SNP77 TCCTTCGCACCTAGTTTCCC 87 A/G 1585 Phosphoinositide 4-kinase beta (Crassostrea gigas) TA: aca-gca
CCTGTAGCATCTGACCTTGACCT
PF_SNP78 AAGATATTATCCAAGGAGCGACC 79 T/A 3056 Manganese-transporting ATPase 13A1-like (Crassostrea gigas) PP: cct-cca
CCGCAAACTGTAAAACTACTGTGAGT
PF_SNP82 ATTGCCTGGAGGAGGTTCG 53 T/C 397 HBS1-like protein (Crassostrea gigas) LL: tta-cta
GACTTGTTCCGGGACAGTTTCT
PF_SNP83 GCGAGGACTACAAACAAGATATG 93 C/A 2545 Enhanced at puberty protein 1-like protein B (Crassostrea gigas) 3'-UTR
CCACGATTTCCAAACCGAG
PF_SNP84 GCATCCGCACAGACCATT 94 G/A 2122 Hypothetical protein CGI_10021394 (Crassostrea gigas) 5'-UTR
TTAGCATCCAGAAGGACTCGA
PF_SNP85 TAACTTCCTTCCCTGCAACTGG 98 A/G 2748 Unknown Unknown
AAGTCCCTCTATCACAGCAAATCAG
PF_SNP88 ATGTTGCTTAGCACGAGCCC 78 G/A 1066 CD63 antigen-like (Crassostrea gigas) VV: gtg-gta
CCTGTCCCCGTCTAGTGTTGT
PF_SNP92 AGAGGAGGGGAAAGCCAA 52 A/G 588 Heterochromatin protein 1-binding protein 3 (Crassostrea gigas) SS: tca-tcg
TGGCATTATCCTCAGACTTCC
PF_SNP95 AACGATTCCCAGGGCGTAC 77 T/C 361 NADH dehydrogenase (ubiquinone) iron-sulfur protein 3, mitochondrial-like isoform X1 (Crassostrea gigas) RR: cgc-cgt
GAAAGGATAGTCATAGAGCCTGTAGAA
PF_SNP98 TCTAATACCGACCAGGCTTCACA 66 A/C 2163 Calcium-responsive transcription factor-like (Aplysia californica) II: ata-atc
CAGATCCGTACACGAGTCTACCATAC
PF_SNP103 CTGAACTGGAAAGGGAAAT 61 A/T 779 Unknown LQ: ctg-cag
GATGCCCATTAGAAATCTTC
PF_SNP105 ACAGCATTCCGCCATGTTTGG 88 A/C 2043 Bromodomain adjacent to zinc finger domain protein 2B (Crassostrea gigas) PP: cca→ccc
CGGGTGACGACGACGAAGATAGA
PF_SNP132 CTCTGCCTTTCTAGCTCCTCTTGC 81 T/C 1904 Unknown KK: aaa-aag
TGCCCGTGAAGCCTTGGAT
PF_SNP134 CGAGCGTACCGTAGTAAATGAAGC 61 A/G 3671 Ubiquitin carboxyl-terminal hydrolase 25 isoform X3 (Chrysemys picta bellii) 3'-UTR
TCAGACATTAGCCAGCGAGACAA
PF_SNP138 GGCTCTAAGTACCGTCCTCACC 58 A/G 2011 Unknown SS: tcg-tca
GCAACAGAATGCCCACAACA
PF_SNP141 GGGTGTCCGTCAAACTTCTT 79 A/G 993 AP-2 complex subunit alpha-2 (Crassostrea gigas) QQ: caa-cag
TCTGTGAGTCTGGTTCTTACTGC
PF_SNP142 AGCTGTAGCCGAGGAGAAG 93 G/A 2079 AP-2 complex subunit alpha-2 (Crassostrea gigas) KK: aag-aaa
TGTGGAGTAGGAGGATGGTTA
PF_SNP147 AACGATTATTTGGCACTGGA 54 C/T 1129 RNA-binding protein PNO1-like (Crassostrea gigas) EE: gag-gaa
AATTGACAGGAGGAAAGTCAGA
PF_SNP155 CATGGGTAGTGTTCACTCTGTGA 72 C/T 2215 Pre-rRNA-processing protein TSR1-like protein (Crassostrea gigas) VV: gtc-gtt
AATGGGTAACCACTAAGGACGA
PF_SNP156 TGAAAGAAAATGGGACAGGT 94 A/G 195 F-box only protein 8 (Crassostrea gigas) NS: aat-agt
TCGTCAAGTCGGGGAA
PF_SNP157 ACATTCCGGCAGACTCAAC 90 G/T 81 Membrane magnesium transporter 1-like (Crassostrea gigas) AA: gct-gcg
TGGGCAGCAGAATATGCA
PF_SNP164 CGCAAAGCATATCGTTAAGTGAGAA 86 T/A 203 SRY-related HMG-domain containing transcription factor 9 (Pinctada fucata) 3'-UTR
TGGGGCTGATTCCTTATGG
PF_SNP168 TTTTGTTCAGTTGGCGGAGA 78 G/A 1079 Uncharacterized protein LOC105333005 isoform X2 (Crassostrea gigas) TA: act-gct
ACCTACTGCCTCTGTTAGTTCTCC
PF_SNP189 TGCTCGCTTCCATCAAC 94 A/T 3855 Hypothetical protein CGI_10025135 (Crassostrea gigas) 3'-UTR
GTCACTTAGGACATCTTCACG
PF_SNP206 CAGGTGGGGAAAATGAGAA 73 A/C 267 Unknown NK: aac-aaa
GGTATACTTGCATAATGTCCGTAC
PF_SNP208 GTTAGAACAGTTGAATGACGAGTC 85 A/G 1457 Unknown KK: aaa-aag
TCTGTCAGCATCCTCCTCAAT
PF_SNP212 ATGAGTTCCACGCCCAGTGA 97 T/G 2415 Unknown SS: tct-tcg
GGAATGTACTGCTTGGTTCGTTAT
PF_SNP213 TCCATTAGTACTCGCCAGTTTAGC 94 G/A 6265 Unknown LL: ttg-tta
CAACTGTCGGGTATCAAAGGAA
PF_SNP214 TTATTGTCCCTGGTAGGCTTCT 48 G/T 699 Unknown Unknown
GCTTGCACGATTAACTAGGATGA
PF_SNP215 ATGCCATAGCCTCCAACCC 78 A/T 805 Unknown PP: cca-cct
CGGCAACCGTTCGTGAAA
PF_SNP219 AGGCAGATGAGTCTACCACCAGG 96 G/A 4887 Unknown PP: ccg-cca
AGAGTGAGGGGACATCAGGAG
PF_SNP221 TGTCAGACCTCTACGGCTAAA 59 T/C 283 RNA polymerase II elongation factor ELL (Gallus gallus) 3'-UTR
GGATTGAGATAACCGAGTGCT
PF_SNP228 GTACATACAATTTGCTCGCTAG 86 G/A 832 Glutaryl-CoA dehydrogenase, mitochondrial (Crassostrea gigas) 3'-UTR
TGTGATACTCAGAATGTCAAGC
PF_SNP229 AAAACGACTAGGTCTGTAGCTGA 80 A/G 294 Unknown QQ: cag-caa
GGATTTCCAAACTTGGACTCTT
PF_SNP231 CTTCGTCGAGGTGAGCTAAA 97 C/A 167 Unknown TK: aca-aaa
TTGATTGCTGAGTGATAGGCT
PF_SNP235 CTATGGTAAACATAGTCGCCATAT 73 G/C 132 Unknown Unknown
ACTAAAGGGGCAAGGAGGTAT
PF_SNP245 TCCCAAGCTGTAACGTCTATCC 72 C/T 1884 Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit alpha isoform (Crassostrea gigas) AV: gcc-gtc
GGGGCTCTATACTATCGAATGTG
PF_SNP246 CTATAAGTGCTACATGCACCAG 73 T/A 109 Unknown Unknown
GTCAAGGTCAGATTTCAATAGTC
PF_SNP251 AACTGTTCATCCCCATCATCTG 83 A/G 583 Histidine triad nucleotide-binding protein 1 (Crassostrea gigas) --:tag-taa
CCCCAAGCTCCTACTCATTTTC
PF_SNP289 GCTGAAACAAAACAAGCCAT 53 T/G 77 Unknown Unknown
CCGTCCTTACCAAATTCTATCT
PF_SNP294 CCATGAACAGAATGAGACCAT 72 4312 C/T Laminin subunit alpha (Crassostrea gigas) YY: tac-tat
TCAACTCTAAGGAATCCGACA
PF_SNP299 CCGAACAAGAATTACGCA 78 A/G 285 Unknown Unknown
TCACATCCTGATTTTGCCT
PF_SNP308 GCAGGCTAAAGCAGTAGGAAAGA 85 C/A 844 Ubiquitin carboxyl-terminal hydrolase 14 (Crassostrea gigas) TT: aca-acc
ATCATCAGGGAACCAATAGGGA
PF_SNP310 TGGGGTGTCCATCGTGAA 80 C/T 1488 SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A member 5 (Crassostrea gigas) LL: tta-cta
AAAAGAAGACAGAGGAACTGAAGAC
PF_SNP312 ATCTGGATCGGTGAACTTGA 54 T/C 271 JNK1-associated membrane protein (Harpegnathos saltator) LL: ttg-ctg
GTTCCGCTCCCCGTTAT
PF_SNP316 TCAGCTCAAGTTCCTCCAGTTC 89 644 A/G Polyglutamine-binding protein 1 (Crassostrea gigas) SS: tcg-tca
TTTGGAGTCATCGTCATAGCG
PF_SNP319 TTCTTATGTCTGACTAAGGGCTCG 86 443 G/A Mitochondrial ribosomal protein S11 (Nilaparvata lugens) PP: cca-ccg
GACACTTGTGCGATGATACTGG
PF_SNP320 CAAGTCAGGTTGGGGCATT 87 615 T/C Stress-70 protein, mitochondrial (Crassostrea gigas) FF: ttt-ttc
GATAGTTTTCTGCGGTTTCTTTC
PF_SNP322 GGATGTTATTCTGGTCGGAGG 100 1251 A/G Stress-70 protein, mitochondrial (Crassostrea gigas) GG: ggg-gga
ATCGGGGTTCACAGCCT
PF_SNP326 TAACCATCCACAGACACCAAGTA 51 420 T/A Small nuclear ribonucleoprotein F (Crassostrea gigas) IN: atc-aac
GCTGAAGTGGGGAATGGAATA
PF_SNP332 CAGAAAGATAACAACTGTGGGG 41 1672 T/C Homologue of Sarcophaga 26, 29 kDa proteinase (Periplaneta americana) VV: gtt-gtc
AAGGTCGGATTGGTGGC
PF_SNP333 ATGCACCACCTACTCAAAGACA 82 790 G/A Putative sodium/potassium-transporting ATPase subunit beta-2 (Crassostrea gigas) 3'--UTR
GACTCAGTATCAAAACAGAAGCAG
PF_SNP337 AGCCTAACGAGTTACCCCAGT 78 915 C/T Pre-mRNA-processing-splicing factor 8 (Crassostrea gigas) DD: gac-gat
CCCATGATGGATTGTCGG
PF_SNP341 CAAGTAGATACCAATGAGCAGCA 85 1392 C/G Histone-lysine N-methyltransferase PRDM9 (Crassostrea gigas) PP: ccg-ccc
CCACATATTGGACAACGTAGGTG
PF_SNP343 AATGACGGAGGAGCGTTACA 65 2048 A/G RAD50-interacting protein 1-like (Aplysia californica) QQ: caa-cag
TCCCCGAATAGAGGAAAGAG
PF_SNP344 ACATCCCTTGAGATGTGAGGG 73 606 A/G Arrestin domain-containing protein 2 (Crassostrea gigas) PP: cca-ccg
GCGGGGAAAACAGACTTGG
PF_SNP347 TTCACCTGACCGCTGTTCC 100 1292 C/G Protein rogdi-like (Crassostrea gigas) VV: gtg-gtc
GGAGATTTCCACATAAACCAGG
PF_SNP357 ATCCAGGGAGAATATCGGG 43 256 T/C Cullin-4A (Crassostrea gigas) VV: gtt-gtc
TTCAGTCATTTGTGGCTCTTC
PF_SNP369 GCCCGTTTGTTCTACCATCG 88 1804 T/C ATP-binding cassette sub-family D member 3 (Crassostrea gigas) VA: gtg-gcg
GGTACATGAATCCTTCTACATCTACAC
PF_SNP374 CAACCTTGGCTAGAGCAACA 81 2109 A/G Protein disulfide-isomerase A3 (Crassostrea gigas) GR: gga-aga
GCAAAAGATTAGCCCCTGAG
PF_SNP375 GATGCTCTGGCAAAGCTACA 93 505 C/T Ras-related GTP-binding protein C (Crassostrea gigas) NN: aac-aat
GCCGTCTACTTTATGTATGAACAC
PF_SNP376 CCTACCTGTATGGCCTACATCC 90 1158 T/C Dynein beta chain, ciliary (Crassostrea gigas) NN: aat-aac
GCTGCATCTCAAACACGGTC
PF_SNP383 TCGTCCCATTCTTCACCG 72 299 T/C Wiskott-Aldrich syndrome protein family member 3 (Crassostrea gigas) PL: ccg-ctg
TGACATGAGGCGTAAAGCTG
PF_SNP399 CCAAATGGAAATTCCGTTGA 65 208 A/G Plancitoxin-1 (Crassostrea gigas) VV: gta-gtg
GCTTTATTCTTGGTGTTCTCAGGTAG
PF_SNP416 AGCAGACCTACCACATCGTT 70 657 A/G Unknown Unknown
TTGTCCATGTAACAGTCCTATCA
PF_SNP425 GTTCTGACTCCTCATTTATAGGGT 93 2497 C/T Unknown Unknown
CCATAAATAGACTGACTGAGGCT
PF_SNP426 TCAGGTACACGTCGATAACA 78 231 G/C Unknown Unknown
TATTGCGCCAGTAACTACAT
PF_SNP427 GATCCCTATAATCGTGTCGCC 77 1039 C/T Unknown HH: cat-cac
GGCTAATTACAGGGACAAATACCA
PF_SNP433 AGCATACTTCAATGATTCCCAGA 62 655 C/T Heat shock protein 70 (Pinctada fucata) AA: gct-gcc
TGAGACCAGCGATTGTGCC
PF_SNP437 AAGAATTTGGTGCAAGATGTG 56 1900 A/T Unknown Unknown
AAAGCGACATTTCCCAGA
PF_SNP441 GCCTTATTGGCATATCTACTATG 89 248 T/A Unknown Unknown
GAGTCGGCTTTTACAAATGAT
PF_SNP444 TTTCGCCCTCGGCAACAA 48 1280 C/T Dolichyl-diphosphooligosaccharide-protein glycosyltransferase subunit 2 (Crassostrea gigas) LL: ctc-ctt
CCAATCAGAAGACGGACCAAGAA
PF_SNP445 GACCAAAGGTCATGTGACCAAGG 84 183 C/A Unknown ED: gaa-gac
GGATAAAGCACGGACTGGAATGT
PF_SNP448 TGCACCTTTAGACACTGTTTGTAC 92 1699 C/T Zinc finger CCCH domain-containing protein 15 (Crassostrea gigas) LL: ctg-cta
AGCAACAGGAGGCTAAGAAAA
PF_SNP454 ACGCATCAATAACTCAGTCTTCG 78 2897 G/A Ribose-phosphate pyrophosphokinase 1 (Crassostrea gigas) TT: aca-acg
GGAGCTTGTTTCATTCTTTCCT
PF_SNP459 TCCCCGTTTGATGCGTC 99 1737 A/G ADP-ribosylation factor-binding protein GGA1-like isoform X1 (Crassostrea gigas) LL: ttg-tta
GGCCGTTGACTGTGGTGA
PF_SNP471 CCTCCTTCTAGGCATAAATTGAC 100 1717 A/G Unknown 3 UTR
TCTCCTCAAAAGACGACACTACTC
PF_SNP474 ACCCGGTTACTGTTTTGGG 83 3323 G/A Protein phosphatase 1E (Crassostrea gigas) Unknown
TGACTTTCGTGCGTGTTCC
PF_SNP480 CGAAACGGACAGTAAGAAAGAA 100 906 C/A Hypothetical protein CGI_10022149 (Crassostrea gigas) TT: acc-aca
ATGGGTTTACGATTGGCAC
PF_SNP482 GCCTTCCATAGATGTAGAGTATTCAG 96 842 G/A Uncharacterized protein LOC105327635 (Crassostrea gigas) LL: cta-ctg
CATAACCTATCCTTTCACATCCC
PF_SNP484 TGCCAAGGACGGAGATG 88 573 T/C Fidgetin-like protein 1 (Crassostrea gigas) 3'-UTR
TCAAAGAAAGGTGAGAATAGCC
PF_SNP485 TATGACATCTATCCAATGGCAAG 92 215 A/T Troponin T (Mizuhopecten yessoensis) 3'-UTR
TCCCCTATTCTTTTGTAGCGTA
PF_SNP488 TCTCGTGATCCCAACGAAGTAGC 84 553 T/G T-complex protein 1 subunit alpha-like (Crassostrea gigas) SS: tct-tcg
AACGGTTGTTCCGGGAGGT
PF_SNP489 GAGGACTGGTTCATTTGTTGTG 66 1060 T/G Unknown Unknown
TGTCAGCGCCCTTATTCC

UTR, untranslated region.

Sequences and predicted and observed melting temperatures of internal temperature controls.

Name Forward/reverse sequence (5'-3')* Predicted temperature (ºC) Observed temperature (ºC)
High-temperature sequences F: GCGGTCAGTCGGCCTAGCGGTAGCCAGCTGCGGCACTGCGTGACGCTCAG 90.02 90.08
R: CTGAGCGTCACGCAGTGCCGCAGCTGGCTACCGCTAGGCCGACTGACCGC
Low-temperature sequences F: ATCGTGATTTCTATAGTTATCTAAGTAGTTGGCATTAATAATTTCATTTT 68.5 68.5
R: AAAATGAAATTATTAATGCCAACTACTTAGATAACTATAGAAATCACGAT

*All of the sequences were blocked with a phosphate at the 3'-end.Amplification of candidate SNPs

PCR amplification was performed in a 25-μL volume containing 1.25 U rTaq polymerase (TaKaRa, Japan), 1X PCR buffer (MgCl2), 0.2 mM dNTPs, 0.2 μM of each primer, and 20-50 ng genomic DNA. The PCR conditions were as follows: pre-incubation at 95°C for 5 min, followed by 30 cycles at 94°C for 20 s, 55°C or 50°C for 30 s, 72°C for 30 s, and a final extension at 72°C for 7 min. All of the PCR products were verified by 8% non-denaturing polyacrylamide gel electrophoresis (PAGE). Only primer pairs that produced a clear target band on the gel were selected for subsequent HRM analysis.

SNP validation and polymorphism detection by HRM analysis

SNP genotyping was performed using the two-step HRM method described by Wang et al. (2013, 2015), with small modifications. Genomic DNA from eight P. fucata individuals was used as amplification templates. After PCR amplification, 8.9 μL PCR product, 0.1 μL of each internal control (10 μM), 0.7 μL LC Green (Idaho Technology Inc., USA), and 20 μL mineral oil (Sigma, USA) were added to BLK/WHT 96-well plates (Bio-Rad, USA). After centrifuging at 2000 g/min for 30 s, the mixture was denatured at 95°C for 10 min using a thermal cycler (Hamburg, Germany). A LightScanner instrument (Idaho Technology Inc., USA) was used for the HRM analysis. Fluorescence intensity data were collected over 55°-98°C at a thermal transition rate of 0.1°C/s. The HRM system software was used to analyze the melt curve peaks and genotypes.

Functional annotation

All of the unigene-obtained polymorphic SNPs were BLASTx searched in the Nr database with an e-value cutoff of 1e-5. SNP positions were determined using open reading frame (ORF) Finder (https://www.ncbi.nlm.nih.gov/orffinder/). SNP mutation type was analyzed using Primer Premier 5.0.

Genetic diversity

Twenty-five polymorphic loci were randomly chosen to examine the genetic diversity of a wild population of P. fucata from Liusha Bay. The PCR process and HRM analysis were performed as described above. The number of alleles per locus, effective number of alleles, observed heterozygosity (HO), expected heterozygosity (HE), and minor allele frequency (MAF) were assessed using the POPGENE 32 software (Yeh et al., 2000), and the polymorphism information content (PIC) was calculated using the PICcalc online software (Nagy et al., 2012).

RESULTS AND DISCUSSION

Small-amplicon HRM assays (SA-HRMAs) provide a rapid, inexpensive, and high-throughput closed-tube method for genotyping (Smith et al., 2010). To ensure SA-HRMA accuracy, we used three criteria: 1) SA-HRMA amplicons were no more than 100 bp long, which ensured that homozygous genotypes of alleles were easily distinguished; 2) only one SNP was present in each amplicon; and 3) high- and low-temperature controls were added for each amplicon, which decreased melting temperature variations attributable to the instrument or solution chemistry and corrected melting profiles (Seipp et al., 2007). An improved two-step SA-HRM method for Pacific oyster (Crassostrea gigas) SNP validation has been shown to be efficient and economical (Wang et al., 2013, 2015), and this method was successfully used to validate 119 polymorphic SNPs from P. fucata transcriptome data, demonstrating that it is feasible in shellfish.

A subset of 468 primers was randomly designed to validate the SNP predictions. No amplification products were seen in 66 sets of primers, and introns were found in genomic DNA but not the transcriptome. If the primer flanked, or was located in, an intron, the intervening fragment could not be amplified. A total of 173 sets of primers amplified multiple bands, and 229 amplified a clear target band on PAGE. The ratio of primer screening was 48.93%, which is higher than previously reported values of 41.67% (Zhang et al., 2015) and 28.10% (Huang et al., 2014b).

All of the SNP-containing unigenes were annotated with the corresponding top best BLASTx hits, and 88 SNPs were annotated though BLASTx in the Nr database (Table 1). Of these, heat-shock protein 70 is expressed in response to changes in temperature, bacterial infection, or pH. Its main function is to promote protein folding, and thereby prevent the cellular accumulation of non-native proteins (Mymrikov et al., 2011). F-box proteins are an expanding family of eukaryotic proteins, characterized by an approximately 40-amino-acid motif (Cenciarelli et al., 1999). F-box proteins were first characterized as components of SCF ubiquitin-ligase complexes, in which they bind substrates for ubiquitin-mediated proteolysis (Kipreos and Pagano, 2000). Fatty acid-binding proteins participate in lipid uptake, transport, and homeostasis (Bayır et al., 2015). Sox9 (SRY-related HMG-domain-containing transcription factor 9) and cullin-3-B play important roles in testis development (Bergstrom et al., 2000; Lu et al., 2005). Among the 229 well-amplified SNPs, 119 (51.97%) were polymorphic in 8 P. fucata individuals, according to the SA-HRMA (Table 1). Seventy-five SNPs were genotyped as transitions, including 40 A/G and 35 C/T, and 44 were genotyped as the transversions 11 A/C, 18 A/T, 6 C/G, and 9 G/T. According to ORF Finder, 90 SNPs were located in the ORF, including 16 non-synonymous SNPs and 74 synonymous SNPs; 12 SNPs were located in the 3'-untranslated region (UTR), and 1 was located in the 5'-UTR. SNPs within a coding sequence may change a protein’s amino acid sequence and structure, thus influencing its functions (Gao et al., 2014; An et al., 2015). The post-transcriptional regulation of gene expression is crucial for many physiological processes. SNPs within UTRs may have consequences for gene splicing, expression, and regulation (Malodobra-Mazur et al., 2016; Xu et al., 2016). SNPs developed from functional genes may be used in association studies, which could genetically improve species. For example, some SNPs are associated with growth traits in the pearl oyster (Shi et al., 2014), and SNPs screened from the myostatin gene are associated with growth traits in the scallop and carp (Wang et al., 2010; Guo et al., 2011; Liu et al., 2012; Sun et al., 2012). All of the annotation unigenes and their SNPs may be useful for studying the commercial traits of P. fucata, such as growth, resistance, and reproduction.

Twenty-five SNPs were successfully used to test the genetic diversity of 40 wild P. fucata from Liusha Bay, China (Table 3). All of the SNP loci had intermediate PIC values (0.25 < PIC < 0.5), with a mean of 0.3336. The HO was 0.0417-0.6042 and the HE was 0.2945-0.5053. Li et al. (2016) used SNP loci to analyze the genetic diversity of P. fucata individuals from three families, and obtained PIC values of 0.2435, 0.2479, and 0.2977. Huang et al. (2014a) used SNP loci to study the genetic diversity of a wild P. fucata population in Shenzhen, China, and reported MAF, HO, and HE values of 0.0642-0.4375, 0.1282-0.4872, and 0.1215-0.4984, respectively. These findings indicate that the Liusha population genetic diversity is higher than that in culture or in the Shenzhen population.

Summary of 25 single nucleotide polymorphisms in wild Pinctada fucata individuals.

Locus NE HO HE MAF PIC
PF_SNP1 1.7041 0.5000 0.4175 0.2917 0.3270
PF_SNP9 1.9321 0.6042 0.4875 0.4062 0.3668
PF_SNP18 1.9965 0.5417 0.5044 0.4792 0.3746
PF_SNP31 1.8221 0.3125 0.4559 0.3438 0.3481
PF_SNP33 1.7771 0.1458 0.4419 0.3229 0.3405
PF_SNP52 1.9459 0.4167 0.4912 0.4167 0.3685
PF_SNP55 1.6265 0.3542 0.3893 0.2604 0.3108
PF_SNP58 1.9991 0.6042 0.5050 0.4896 0.3749
PF_SNP64 1.4113 0.2292 0.2945 0.1771 0.2516
PF_SNP67 1.9584 0.4792 0.4945 0.4271 0.3700
PF_SNP68 1.9965 0.2500 0.5044 0.4792 0.3746
PF_SNP69 1.8824 0.4583 0.4737 0.3750 0.3589
PF_SNP70 2.0000 0.4583 0.5053 0.5000 0.3750
PF_SNP71 1.5463 0.2917 0.3570 0.2292 0.2915
PF_SNP73 1.8000 0.4583 0.4491 0.3333 0.3444
PF_SNP75 1.8633 0.1875 0.4682 0.3646 0.3546
PF_SNP77 1.6000 0.2500 0.3789 0.2500 0.3047
PF_SNP82 1.9692 0.5000 0.4974 0.4375 0.3714
PF_SNP83 1.8432 0.0417 0.4623 0.3542 0.3515
PF_SNP84 1.5463 0.2500 0.3570 0.2292 0.2915
PF_SNP88 1.4922 0.1667 0.3333 0.2083 0.2768
PF_SNP92 1.7041 0.5833 0.4175 0.2917 0.3270
PF_SNP95 1.5463 0.2917 0.3570 0.2292 0.2915
PF_SNP98 1.4922 0.1667 0.3333 0.2083 0.2768
PF_SNP103 1.6528 0.4167 0.3991 0.2708 0.3165
Average 1.7643 0.3583 0.4310 0.3350 0.3336

HE, expected heterozygosity; HO, observed heterozygosity; MAF, minor allele frequency; NE, effective number of alleles; PIC, polymorphism information content.

HRM technology can directly distinguish between different genotypes based on melting peak profiles (Smith et al., 2010). Figure 1a and b show the melting curve analyses of PF_SNP9 and PF_SNP98, respectively.

Genotyping results using high-resolution melting with a small amplicon. a. PF_SNP9, homozygotes (GG and CC) and heterozygotes (GC) are represented by red, blue, and gray curves, respectively. b. PF_SNP98, homozygotes (AA and CC) and heterozygotes (CA) are represented by gray, blue, and red curves, respectively.

In conclusion, 119 polymorphic SNPs were successfully isolated by SA-HRMA, thus contributing to our understanding of P. fucata genetics and breeding.
Conflicts of interest